Journal:

Article Title: Analysis of Structural and Physiological Profiles To Assess the Effects of Cu on Biofilm Microbial Communities

doi: 10.1128/AEM.70.8.4512-4521.2004

Figure Lengend Snippet: Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using the Phoretix 1D software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.

Article Snippet: The temperature program of the eukaryotic PCR was as follows: 5 min at 94°C; 30 cycles with an annealing temperature of 60°C (30 s) for the first 5 cycles and a touchdown step (in which the annealing temperature was decreased from 60 to 55°C) for 25 cycles, and extension at 68°C for 90 s. The final extension step lasted 10 min. PCR product concentrations were estimated by separation on 1% agarose gels stained with ethidium bromide and digital gel image analysis using Phoretix 1D software (Nonlinear Dynamics, Newcastle, United Kingdom). table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Primer a Sequence (5′ to 3′) Target site Characteristic GC-EUK1427F TCTGTGATGCCCTTAGATGTTCTGGG b 1427-1453 d Eukaryotic primer EUK1616R GCGGTGTGTACAAAGGGCAGGG 1616-1637 d Eukaryotic primer GC-CYA371F CAGCAGTGGGGAATTTTCC c 371-390 e Cyanobacterial primer CYA783R GACTACWGGGGTATCTAATCCCW 738-761 e Cyanobacterial primer GC-357F CCTACGGGAGGCAGCAG b 357-374 e Universal bacterial primer R518 ATTACCGCGGCTGCTGG 518-525 e Universal bacterial primer Open in a separate window a R (reverse) and F (forward) designations refer to primer orientation in relation to the rRNA. b A 40-nucleotide GC-rich clamp (5′-CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC-3′) is attached to the 5′ end of the primer. c A 40-nucleotide GC-rich clamp (5′-CGCCCGCCGCGCCCCGCGCCGGTCCCGCCGCCCCGCCCG-3′) is attached to the 5′ end of the cyanobacterial primer. d Saccharomyces cerevisiae numbering of 18S rRNA nucleotides. e Escherichia coli numbering of 16S rRNA nucleotides.

Techniques: Software, Generated